慢病毒包裝教程(LentivirusPackagingandProduction)

1、Lentivirus Packaging and Production The laboratories of Didier Trono (EPFL) and Robert Weinberg (Whitehead Institute) have deposited plasmids for the production of lentiviral particles. These plasmids can be used with many lentiviral vectors, including The RNAi Consortium shRNA vectors being distrib

2、uted by Sigma (i.e. MISSION shRNAs) and Open Biosystems (i.e. TRC shRNAs). Overview For producing lentiviral particles, you typically need three components: 1) a lentiviral vector, such as HYPERLINK /10878pLKO.1 or HYPERLINK /12247pLVTHM, containing the shRNA or transgene, 2) a packaging vector, suc

3、h as HYPERLINK /12260psPAX2 or HYPERLINK /8455pCMV-dR8.2 dvpr, and 3) an envelope vector, such as HYPERLINK /12259pMD2.G or HYPERLINK /8454pCMV-VSVG. For most applications, you can produce viral particles by transient transfection of 293T cells with a 2nd generation packaging system (e.g. packaging

4、plasmid psPAX2 and envelope plasmid pMD2.G). 2nd Generation Packaging System In general, lentiviral vectors with a wildtype 5 LTR need the 2nd generation packaging system because these vectors require TAT for activation. All lentiviral vectors from the Trono or Aebischer lab require packaging with a

5、 2nd generation system. Below are two 2nd generation systems. Lentiviral plasmids based on pLKO.1 can be packaged with either system, although the first system has been reported to produce higher titer. See HYPERLINK /plkoAddgenes pLKO.1 Protocol for producing lentiviral particles. 2nd generation sy

6、stem deposited by the Trono lab: ID/FONT PlasmidDescriptionHYPERLINK /pgvec1?f=c&cmd=findpl&identifier=1226012260 psPAX22nd generation packaging plasmid for producing viral particles. psPAX2 contains a robust CAG promoter for efficient expression of packaging proteins. Trono lab and Aebischer lab le

7、ntiviral vectors require psPAX2. Produces higher titer than pCMV-dR8.2 dvpr. HYPERLINK /pgvec1?f=c&cmd=findpl&identifier=1225912259 pMD2.GEnvelope plasmid for producing viral particles 2nd generation system deposited by the Weinberg lab: ID/FONT PlasmidDescriptionHYPERLINK /pgvec1?f=c&cmd=findpl&ide

8、ntifier=84558455 pCMV-dR8.2 dvpr2nd generation packaging plasmid for producing viral particles HYPERLINK /pgvec1?f=c&cmd=findpl&identifier=84548454 pCMV-VSVGEnvelope plasmid for producing viral particles 3rd Generation Packaging System The 3rd generation packaging system offers maximal biosafety but

9、 is more cumbersome to use, as it involves the transfection of four different plasmids in the producer cells (two packaging plasmids, an envelope plasmid, and the lentiviral vector). If you wish to use this system, you need to have a lentiviral vector with a chimeric 5 LTR in which the HIV promoter

10、is replaced with CMV or RSV, thus making it TAT-independent. Examples of these vectors include pLKO.1, pLL3.7, pLB, pLenti6, pSico, pCL, and pCS. Most Aebischer and Trono Lab lentiviral vectors CANNOT be used with this system. A lentiviral vector carrying a chimeric 5 LTR can be packaged with either

11、 the 2nd or 3rd generation packaging system. ID/FONT PlasmidDescriptionHYPERLINK /pgvec1?f=c&cmd=findpl&identifier=1225112251 pMDLg/pRRE3rd generation packaging plasmid for producing viral particles HYPERLINK /pgvec1?f=c&cmd=findpl&identifier=1225312253 pRSV-Rev3rd generation packaging plasmid for p

12、roducing viral particles HYPERLINK /pgvec1?f=c&cmd=findpl&identifier=1225912259 pMD2.GEnvelope plasmid for producing viral particles More information Click HYPERLINK /rnaitoolshere to browse other RNAi vectors, or search for plasmids using the search bar at the top of the page. HYPERLINK http:/trono

13、lab.epfl.ch/Trono Lab website or HYPERLINK Lentiweb: information and a discussion forum on cloning, packaging, and other protocols. Moffat J et. al. 2006. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell 124:1283-1298. (HYPERLINK /entrez/query

14、.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&list_uids=16564017PubMed) Ventura et. al. 2004. Cre-lox-regulated conditional RNA interference from transgenes. PNAS 2004 Jul 13;101(28):10380-5. (HYPERLINK /entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&list_uids=15240889PubMed) Naldini L et. al.

15、1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272:263-267. (HYPERLINK /entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&list_uids=8602510PubMed) Dull et al., A Third-Generation Lentivirus Vector with a Conditional Packaging System. J.

16、Virol. 1998 72(11): 8463-8472. (HYPERLINK /entrez/query.fcgi?db=pubmed&cmd=Retrieve&dopt=Abstract&list_uids=9765382PubMed) Zufferey R et. al. 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol 15(9):871-5. (HYPERLINK /entrez/query.fcgi?cmd=Retrieve&d

17、b=pubmed&dopt=Abstract&list_uids=9306402PubMed) Zufferey R et. al. 1998. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol 72(12):9873-80. (HYPERLINK /entrez/query.fcgi?cmd=Retrieve&db=pubmed&dopt=Abstract&list_uids=9811723PubMed) Cell Line The 293T cell line

18、for producing lentiviral particles can be obtained from HYPERLINK /run/jumpto.pl?tag=rnaitools&url=http%3A%2F%2F%2Fproducts%2Faptag-3%2Findex.htmlGenHunter. pLKO.1 Protocol pLKO.1 - TRC Cloning Vector Addgene Plasmid 10878. Protocol Version 1.0. December 2006. Copyright Addgene 2006, All Rights Rese

19、rved. This protocol is provided for your convenience. See HYPERLINK /pgvec1?f=c&cmd=showcol&colid=170&page=2 l appendixwarranty information in appendix. Click HYPERLINK /pgvec1?f=c&cmd=showcol&colid=170&page=2&pf=truehere for a printable copy. Table of Contents HYPERLINK /pgvec1?f=c&cmd=showcol&coli

20、d=170&page=2 l plkoA. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium A.2 Map of pLKO.1 A.3 Related plasmids HYPERLINK /pgvec1?f=c&cmd=showcol&colid=170&page=2 l oligosB. Designing shRNA Oligos for pLKO.1 B.1 Determine the optimal 21-mer targets in your gene B.2 Order oligos compatible with pLKO.1

21、 HYPERLINK /pgvec1?f=c&cmd=showcol&colid=170&page=2 l cloningC. Cloning shRNA oligos into pLKO.1 C.1 Recommended materials C.2 Annealing oligos C.3 Digesting pLKO.1 TRC-Cloning Vector C.4 Ligating and transforming into bacteria HYPERLINK /pgvec1?f=c&cmd=showcol&colid=170&page=2 l screenD. Screening

22、for Inserts D.1 Recommended materials D.2 Screening for inserts HYPERLINK /pgvec1?f=c&cmd=showcol&colid=170&page=2 l lentiE. Producing Lentiviral Particles E.1 Recommended materials E.2 Protocol for producing lentiviral particles HYPERLINK /pgvec1?f=c&cmd=showcol&colid=170&page=2 l infectF. Infectin

23、g Target Cells F.1 Recommended materials F.2 Determining the optimal puromycin concentration F.3 Protocol for lentiviral infection and selection HYPERLINK /pgvec1?f=c&cmd=showcol&colid=170&page=2 l safetyG. Safety HYPERLINK /pgvec1?f=c&cmd=showcol&colid=170&page=2 l refsH. References H.1 Published a

24、rticles H.2 Web resources HYPERLINK /pgvec1?f=c&cmd=showcol&colid=170&page=2 l appendixI. Appendix I.1 Sequence of pLKO.1 TRC-Cloning Vector I.2 Recipes I.3 Warranty information HYPERLINK /pgvec1?f=c&cmd=showcol&colid=170&page=2Back to Top A. pLKO.1-TRC Cloning Vector A.1 The RNAi Consortium The HYP

25、ERLINK /10878pLKO.1 cloning vector is the backbone upon which HYPERLINK /genome_bio/trcThe RNAi Consortium (TRC) has built a library of shRNAs directed against 15,000 human and 15,000 mouse genes. Addgene is working with the TRC to make this shRNA cloning vector available to the scientific community

26、. Please cite Moffat et al., Cell 2006 Mar; 124(6):1283-98 (HYPERLINK /entrez/query.fcgi?cmd=retrieve&db=pubmed&dopt=abstract&list_uids=16564017PubMed) in all publications arising from the use of this vector. A.2 Map of pLKO.1 pLKO.1 is a replication-incompetent lentiviral vector chosen by the TRC f

27、or expression of shRNAs. pLKO.1 can be introduced into cells via direct transfection, or can be converted into lentiviral particles for subsequent infection of a target cell line. Once introduced, the puromycin resistance marker encoded in pLKO.1 allows for convenient stable selection. Figure 1 : Ma

28、p of pLKO.1 containing an shRNA insert. The original pLKO.1-TRC cloning vector has a 1.9kb stuffer that is released by digestion with AgeI and EcoRI. shRNA oligos are cloned into the AgeI and EcoRI sites in place of the stuffer. The AgeI site is destroyed in most cases (depending on the target seque

29、nce), while the EcoRI site is preserved. For a complete map of pLKO.1 containing the 1.9kb stuffer, visit HYPERLINK /10878/10878. DescriptionVector ElementU6Human U6 promoter drives RNA Polymerase III transcription for generation of shRNA transcripts.cPPTCentral polypurine tract, cPPT, improves tran

30、sduction efficiency by facilitating nuclear import of the vectors preintegration complex in the transduced cells. hPGKHuman phosphoglycerate kinase promoter drives expression of puromycin. Puro RPuromycin resistance gene for selection of pLKO.1 plasmid in mammalian cells.sin 3LTR3 Self-inactivating

31、long terminal repeat.f1 orif1 bacterial origin of replication.Amp RAmpicillin resistance gene for selection of pLKO.1 plasmid in bacterial cellspUC oripUC bacterial origin of replication.5LTR5 long terminal repeat.RRERev response element.Figure 2 : Detail of shRNA insert. The U6 promoter directs RNA

32、 Polymerase III transcription of the shRNA. The shRNA contains 21 sense bases that are identical to the target gene, a loop containing an XhoI restriction site, and 21 antisense bases that are complementary to the sense bases. The shRNA is followed by a polyT termination sequence for RNA Polymerase

33、III. A.3 Related Products The following plasmids available from Addgene are recommended for use in conjunction with the pLKO.1 TRC-cloning vector. Plasmid (Addgene ID #)DescriptionHYPERLINK /10879pLKO.1 - TRC control (10879) Negative control vector containing non-hairpin insert. HYPERLINK /1864pLKO.

34、1 - scramble shRNA (1864) Negative control vector containing scrambled shRNA. HYPERLINK /12260psPAX2 (12260) Packaging plasmid for producing viral particles. HYPERLINK /12259pMD2.G (12259) Envelope plasmid for producing viral particles. Note: pLKO.1 can also be used with packaging plasmid HYPERLINK

35、/8455pCMV-dR8.2 dvpr (Addgene #8455) and envelope plasmid HYPERLINK /8454pCMV-VSVG (Addgene #8454) from Robert Weinbergs lab. For more information, visit Addgenes HYPERLINK /rnaitoolsMammalian RNAi Tools page. Several other laboratories have deposited pLKO derived vectors that may also be useful for

36、 your experiment. To see these vectors, visit Addgenes website and HYPERLINK /pgvec1?identifier=pLKO&f=c&cmd=searchplsearch for pLKO. HYPERLINK /pgvec1?f=c&cmd=showcol&colid=170&page=2Back to Top B. Designing shRNA Oligos for pLKO.1 B.1 Determining the Optimal 21-mer Targets in your Gene Selection o

37、f suitable 21-mer targets in your gene is the first step toward efficient gene silencing. Methods for target selection are continuously being improved. Below are suggestions for target selection. 1. Use an siRNA selection tool to determine a set of top-scoring targets for your gene. For example, the

38、 Whitehead Institute for Biomedical Research hosts an siRNA Selection Program that can be accessed after a free registration (HYPERLINK /bioc/siRNAext/bioc/siRNAext/). If you have MacOS X, another excellent program is iRNAi, which is provided free by the company Mekentosj (HYPERLINK /irnai/irnai/).

39、A summary of guidelines for designing siRNAs with effective gene silencing is included here: Starting at 25nt downstream of the start codon (ATG), search for 21nt sequences that match the pattern AA(N19). If no suitable match is found, search for NAR(N17)YNN, where N is any nucleotide, R is a purine

40、 (A,G), and Y is a pyrimidine (C,U). G-C content should be 36-52%. Sense 3 end should have low stability at least one A or T between position 15-19. Avoid targeting introns. Avoid stretches of 4 or more nucleotide repeats, especially repeated Ts because polyT is a termination signal for RNA polymera

41、se III. 2. To minimize degradation of off-target mRNAs, use NCBIs BLAST program. Select sequences that have at least 3 nucleotide mismatches to all unrelated genes. Addgene recommends that you select multiple target sequences for each gene. Some sequences will be more effective than others. In addit

42、ion, demonstrating that two different shRNAs that target the same gene can produce the same phenotype will alleviate concerns about off-target effects. B.2 Ordering Oligos Compatible with pLKO.1 To generate oligos for cloning into pLKO.1, insert your sense and antisense sequences from step B.1 into

43、the oligos below. Do not change the ends; these bases are important for cloning the oligos into the pLKO.1 TRC-cloning vector. Forward oligo: 5 CCGG21bp senseCTCGAG21bp antisenseTTTTTG 3 Reverse oligo: 5 AATTCAAAAA21bp senseCTCGAG21bp antisense 3 For example, if the target sequence is (AA)TGCCTACGTT

44、AAGCTATAC, the oligos would be: Forward oligo: 5 CCGGAATGCCTACGTTAAGCTATACCTCGAGGTATAGCTTAACGTAGGCATTTTTTTG 3 Reverse oligo: 5 AATTCAAAAAAATGCCTACGTTAAGCTATACCTCGAGGTATAGCTTAACGTAGGCATT 3 HYPERLINK /pgvec1?f=c&cmd=showcol&colid=170&page=2Back to Top C. Cloning Oligos into pLKO.1 The pLKO.1-TRC cloni

45、ng vector contains a 1.9kb stuffer that is released upon digestion with EcoRI and AgeI. The oligos from section B contain the shRNA sequence flanked by sequences that are compatible with the sticky ends of EcoRI and AgeI. Forward and reverse oligos are annealed and ligated into the pLKO.1 vector, pr

46、oducing a final plasmid that expresses the shRNA of interest. C.1 Recommended Materials MaterialVendor and catalog #AgeI New England Biolabs (NEB) #R0552S EcoRI NEB #R0101S T4 DNA ligase NEB #M0202S NEB buffer 2 NEB #B7002S DH5 alpha competent cells Invitrogen #18258-012 Qiaquick gel extraction kit

47、Qiagen #28704 Low melting point agarose Sigma #A9414 Luria Broth Agar (LB agar) American Bioanalytical: #AB01200-02000 Ampicillin VWR: #7177-48-2. Use at 100 g/mL. Carbenicillin VWR: #80030-956. Use at 100 g/mL. C.2 Annealing Oligos 1. Resuspend oligos in ddH2O to a concentration of 20 M, then mix:

48、5 LForward oligo5 LReverse oligo5 L10 x NEB buffer 235 LddH2O2. Incubate for 4 minutes at 95oC in a PCR machine or in a beaker of boiling water. 3. If using a PCR machine, incubate the sample at 70oC for 10 minutes then slowly cool to room temperature over the period of several hours. If using a bea

49、ker of water, remove the beaker from the flame, and allow the water to cool to room temperature. This will take a few hours, but it is important for the cooling to occur slowly for the oligos to anneal. C.3 Digesting pLKO.1 TRC Cloning Vector 1. Digest pLKO.1 TRC-cloning vector with AgeI. Mix: 6 gpL

50、KO.1 TRC-cloning vector (maxiprep or miniprep DNA)5 L10 x NEB buffer 11 LAgeIto 50 LddH2O Incubate at 37oC for 2 hours. 2. Purify with Qiaquick gel extraction kit. Elute in 30 L of ddH2O. 3. Digest eluate with EcoRI. Mix: 30 LpLKO.1 TRC-cloning vector digested with AgeI5 L10 x NEB buffer for EcoRI1

51、LEcoRI14 LddH2O Incubate at 37oC for 2 hours. 4. Run digested DNA on 0.8% low melting point agarose gel until you can distinctly see 2 bands, one 7kb and one 1.9kb. Cut out the 7kb band and place in a sterile microcentrifuge tube. When visualizing DNA fragments to be used for ligation, use only long

52、-wavelength UV light. Short wavelength UV light will increase the chance of damaging the DNA. 5. Purify the DNA using a Qiaquick gel extraction kit. Elute in 30 L of ddH2O. 6. Measure the DNA concentration. C.4 Ligating and Transforming into Bacteria 1. Use your ligation method of choice. For a stan

53、dard T4 ligation, mix: 2 Lannealed oligo from step C.2.20 ngdigested pLKO.1 TRC-cloning vector from step C.3. (If you were unable to measure the DNA concentration, use 1 L)2 L10 x NEB T4 DNA ligase buffer1 LNEB T4 DNA ligaseto 20 LddH2O Incubate at 16oC for 4-20 hours. 2. Transform 2 L of ligation m

54、ix into 25 L competent DH5 alpha cells, following manufacturers protocol. Plate on LB agar plates containing 100 g/mL ampicillin or carbenicillin (an ampicillin analog). HYPERLINK /pgvec1?f=c&cmd=showcol&colid=170&page=2Back to Top D. Screening for Inserts You may screen for plasmids that were succe

55、ssfully ligated by restriction enzyme digestion. However, once you have identified the positive clones, it is important to verify the insert by conducting a sequencing reaction. D.1 Recommended Materials MaterialVendor and catalog #DNA Miniprep Kit Qiagen #27104 EcoRI NEB #R0101S NcoI NEB #R0193S Ag

56、arose Sigma #A9539 D.2 Screening for Inserts Day 1: 1. Innoculate 5 colonies from each ligation into LB + 100 g/mL ampicillin or carbenicillin. Day 2: 2. Spin down the cultures and use a miniprep kit to obtain DNA. 3. Conduct a restriction digest with EcoRI and NcoI: 1 gminiprep DNA2 L10 x NEB buffe

57、r for EcoRI0.8 LEcoRI0.8 LNcoIto 20 LddH2O Incubate at 37oC for 1-2 hours. 4. Run the digestion products on a 1% agarose gel. You should see two fragments, a 2kb fragment and a 5kb fragment. 5. Sequence positive clones with pLKO.1 sequencing primer (5 CAA GGC TGT TAG AGA GAT AAT TGG A 3). You may ne

58、ed to adjust the sequencing conditions if the DNA polymerase has difficulty reading through the secondary structure of the hairpin sequence. HYPERLINK /pgvec1?f=c&cmd=showcol&colid=170&page=2Back to Top E. Producing Lentiviral Particles Before this step, you must contact your institutions Bio-Safety

59、 office to receive permission and institution-specific instructions. You must follow safety procedures and work in an environment (e.g. BL2+) suitable for handling HIV-derivative viruses. For transient knockdown of protein expression, you may transfect plasmid DNA directly into the target cells. The

60、 shRNA will be expressed, but the DNA is unlikely to be integrated into the host genome. For stable loss-of-function experiments, Addgene recommends that you generate lentiviral particles and infect the target cells. Addition of puromycin will allow you to select for cells that stably express your s